Archives

  • 2018-07
  • 2020-07
  • 2020-08
  • UAGACAUUGGGUUCGCCGUTT N A br siCul CCCUUGGAGAAAGACUUUAUA N A

    2020-08-12

    UAGACAUUGGGUUCGCCGUTT N/A
    siCul2 CCCUUGGAGAAAGACUUUAUA N/A
    siCul4B AAGGTGCGAGAAGATGTA N/A
    siCul3-1 AAGGUGCGAGAAGAUGUATT N/A
    siCul3-2 AACAACUUUCUUCAAACGCUA N/A
    siCul3-3 AACAACACUUGGCAAGGAGAC N/A
    siSPOP-1 CAACUAUCAUGCUUCGGAU N/A
    siSPOP-2 GGUAAAGGUUCCUGAGUGC N/A
    siSPOP-3 AAAUGGUGUUUGCGAGUAA N/A
    siSPOP-4 UAGAACUUUUAAUGACUUCAC N/A
    siBRAF-1 GGUGUGGAAUAUCAAACAATT N/A
    siBRAF-2 GGCUCACUAACUAACGUGATT N/A
    siBRAF-3 AAACGUUUUUCGUACAAAGUU N/A
    siBRAF-4
    AUUCAUACAGAACAAUUCCAA
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    Recombinant DNA
    pcDNA3.1-HA-NANOG In our lab N/A
    pcDNA3.1-Flag-dnCul1 In our lab N/A
    pcDNA3.1-Flag-dnCul2 In our lab N/A
    pcDNA3.1-Flag-dnCul3 In our lab N/A
    pcDNA3.1-Flag-dnCul4A In our lab N/A
    pcDNA3.1-Flag-dnCul4B In our lab N/A
    pcDNA3.1-Flag-GFP In our lab N/A
    pcDNA3.1-HA-SPOP In our lab N/A
    pcDNA3.1-Flag-NANOG In our lab N/A
    pcDNA3.1-His-ubiquitin In our lab N/A
    pcDNA3.1-Flag-SPOP In our lab N/A
    pcDNA3.1-Flag-SPOPDBTB In our lab N/A
    pcDNA3.1-Flag-SPOPDMATH In our lab N/A
    pcDNA3.1-HA-SPOPDBTB In our lab N/A
    pcDNA3.1-HA-SPOPDMATH In our lab N/A
    Lenti-pWPI-Flag-SPOP In our lab N/A
    Lenti-pWPI-Flag-SPOP-F133L In our lab N/A
    Lenti-pWPI-Flag-SPOP-Y87C In our lab N/A
    Lenti-pWPI-Flag-NANOG In our lab N/A
    pcDNA3.1-HA-NANOG-DPDSST In our lab N/A
    pcDNA3.1-HA-NANOG-3A In our lab N/A
    pcDNA3.1-Flag-NANOG-DPDSST In our lab N/A
    pGEX-4T-2-GST-SPOP In our lab N/A
    pcDNA3.1-Flag-NANOG-S65A In our lab N/A
    pcDNA3.1-Flag-NANOG-P66A In our lab N/A
    pcDNA3.1-Flag-NANOG-D67A In our lab N/A
    pcDNA3.1-Flag-NANOG-S68A In our lab N/A
    pcDNA3.1-Flag-NANOG-S69A In our lab N/A
    pcDNA3.1-Flag-NANOG-T70A In our lab N/A
    pcDNA3.1-Flag-NANOG-S71A In our lab N/A
    pcDNA3.1-Flag-NANOG-P72A In our lab N/A
    pcDNA3.1-Flag-NANOG-S68Y In our lab N/A
    Lenti-pWPI-Flag-NANOG-S68Y In our lab N/A
    pcDNA3.1-Flag-NANOG-S68D In our lab N/A
    NANOG reporter plasmid Dr. Duanqing Pei, Guangzhou Institutes Puromycin dihydrochloride Biomedicine N/A
    and
    Health
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    pcDNA3.1-HA-AKT In our lab N/A
    pcDNA3.1-HA-ARAF In our lab N/A
    pcDNA3.1-HA-BRAF In our lab N/A
    pcDNA3.1-HA-CRAF In our lab N/A
    pcDNA3.1-Flag-BRAF In our lab N/A
    pET28a-His-NANOG In our lab N/A
    Retro-Migr-Venus-Mir30-shSPOP In our lab N/A
    Retro-Migr-Venus-Mir30-shNANOG In our lab N/A
    pGEX-4T-2-GST-SPOP-DBTB In our lab N/A
    pGEX-4T-2-GST-SPOP-DMATH In our lab N/A
    pcDNA3.1-Flag-KCTD2 In our lab N/A
    pcDNA3.1-Flag-KCTD5 In our lab N/A
    pcDNA3.1-Flag-BACURD2 In our lab N/A
    pcDNA3.1-Flag-KLHL9 In our lab N/A
    pcDNA3.1-Flag-KLHL13 In our lab N/A
    pcDNA3.1-Flag-KLHL15 In our lab N/A
    pcDNA3.1-Flag-KLHL17 In our lab N/A
    pcDNA3.1-Flag-KLHL22 In our lab N/A
    pcDNA3.1-Flag-KLHL24 In our lab N/A
    Lenti-pWPI-Flag-NANOG-DPDSST In our lab
    CONTACT FOR REAGENT AND RESOURCE SHARING
    Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact, Ping Wang (wangp@tongji.
    EXPERIMENTAL MODEL AND SUBJECT DETAILS
    Cell Culture
    PC3 (male), 22RV1 (male), LNCaP (male) cells were cultured in RPMI 1640 medium supplemented with 10% FBS. DU145 (male), SPOP WT and KO DU145 (male), AMPKa1/a2 WT and KO MEFs (a kind gift from Dr.Jia Li, National Center for Drug Screening, China) and human embryonic kidney 293T (from Cell Bank, Chinese Academy of Sciences) cells were cultured in DMEM medium supple-mented with 10% heat-inactivated fetal bovine serum. E14 mESCs (a kind gift from Dr.Xin Xie, National Center for Drug Screening, China) were maintained on feeder-free gelatin-coated plastics cultured by mES medium (DMEM with 15% FBS (Gibco 10099), 2mM GlutaMAX, 0.1 mM non-essential amino acids (NEAA), 0.1 mM b-mercaptoethanol, 100 U/ml penicillin and 100 mg/ml streptomycin) supplemented with 1000 U/ml LIF and passaged every 3 days. Cells were cultured at 37 C supplied with 5% CO2. Transfection was performed by using calcium phosphate-DNA coprecipitation for HEK293T cells and using Lipofectamine 2000 for DU145, LNCaP, PC3 and E14 cells.
    In Vivo Xenograft Assay
    All treatments were administered according to the guidelines of Institution Animal Care and Use Committee and all the protocols were approved by East China Normal University and Tongji University. Mice were caged in the groups of five in a laminar airflow cabinet under specific pathogen-free conditions, fed with sterilized food and water, and kept on a 12 hr light/dark cycle. Serial limiting dilution DU145 (AR-) or 22RV1 (AR+) cells were admixed with Matrigel and injected into the backside of male 6-week-old BALB/cA nude mice. The animals were checked two to three times per week. Mean of primary, secondary and tertiary tumor volumes at 5 weeks.